ONGene
Top
Scroll To Top
Gene information | Literature | Expression | lncRNA | Mutation | Homolog

Basic Information

Gene ID

768216

Name

MIR454

Synonym

MIRN454|hsa-mir-454;microRNA 454;MIR454;microRNA 454

Definition

-

Position

17q22

Gene Type

ncRNA

External Links

Links to cell senescence gene database

768216

Links to epithelial mesenchymal transition gene database

768216

Links to ovarian cancer gene database

768216

Links to endometrial cancer gene database

768216

Links to iHOP

768216

Sequence Information

Nucleotide Sequence

>768216 : length: 115
TCTGTTTATCACCAGATCCTAGAACCCTATCAATATTGTCTCTGCTGTGTAAATAGTTCT
GAGTAGTGCAATATTGCTTATAGGGTTTTGGTGTTTGGAAAGAACAATGGGCAGG

Protein Sequence

>768216 : length: 3
N/A