ONGene
Top
Scroll To Top
Gene information | Literature | Expression | lncRNA | Mutation | Homolog

Basic Information

Gene ID

728655

Name

HULC

Synonym

HCCAT1|LINC00078|NCRNA00078;hepatocellular carcinoma up-regulated long non-coding RNA;HULC;hepatocellular carcinoma up-regulated long non-coding RNA

Definition

hepatocellular carcinoma associated transcript 1 (non-protein coding)|highly up-regulated in liver cancer (non-protein coding)|highly up-regulated in liver cancer long non-coding RNA|long intergenic non-protein coding RNA 78

Position

6p24.3

Gene Type

ncRNA

External Links

Links to cell senescence gene database

728655

Links to epithelial mesenchymal transition gene database

728655

Links to ovarian cancer gene database

728655

Links to endometrial cancer gene database

728655

Links to iHOP

728655

Sequence Information

Nucleotide Sequence

>728655 : length: 500
ATGGGGGTGGAACTCATGATGGAATTGGAGCCTTTACAAGGGAATGAAGAGACAAGAGCT
CTCTTTATGCCACGTGAGGATACAGCAAGGCCCCAATCTGCAAGCCAGGAAGAGTCGTCA
CGAGAACCAGACCATGCAGGAACTCTGATCGTGGACATTTCAACCTCCAGAACTGTGATC
CAAAATGCATATGTATCTTTGGAAGAAACTCTGAAGTAAAGGCCGGAATATTCTTTGTTT
AAAACATTAAAAACAAAACAGACCAAAGCATCAAGCAAGAAGTTTCCTGGCAATAAACTA
AGCACAGCATTATTTTTTAAGGAACACAAATTAAGTGTTCAACCTGTGGCAAATTTGTAC
TTTCTCCCTGAATTATGTTGTTATCAAAGAAAAAAATTGGGAAGCATGGCAAAATATCAT
CAAAACTGAAACTAGAATTAAACAAAACTAAATTAAAATGAAATAAAATGATGTCCATTC
TTAAAAAAAAAAAAAAAAAA

Protein Sequence

>728655 : length: 3
N/A