ONGene
Top
Scroll To Top
Gene information | Literature | Expression | lncRNA | Mutation | Homolog

Basic Information

Gene ID

724033

Name

MIR663A

Synonym

MIR663|MIRN663|hsa-mir-663|hsa-mir-663a;microRNA 663a;MIR663A;microRNA 663a

Definition

microRNA 663

Position

20p11.1

Gene Type

ncRNA

External Links

Links to cell senescence gene database

724033

Links to epithelial mesenchymal transition gene database

724033

Links to ovarian cancer gene database

724033

Links to endometrial cancer gene database

724033

Links to iHOP

724033

Sequence Information

Nucleotide Sequence

>724033 : length: 93
CCTTCCGGCGTCCCAGGCGGGGCGCCGCGGGACCGCCCTCGTGTCTGTGGCGGTGGGATC
CCGCGGCCGTGTTTTCCTGGTGGCCCGGCCATG

Protein Sequence

>724033 : length: 3
N/A