ONGene
Top
Scroll To Top
Gene information | Literature | Expression | lncRNA | Mutation | Homolog

Basic Information

Gene ID

693235

Name

MIR92B

Synonym

MIRN92B|hsa-mir-92b;microRNA 92b;MIR92B;microRNA 92b

Definition

-

Position

1q22

Gene Type

ncRNA

External Links

Links to cell senescence gene database

693235

Links to epithelial mesenchymal transition gene database

693235

Links to ovarian cancer gene database

693235

Links to endometrial cancer gene database

693235

Links to iHOP

693235

Sequence Information

Nucleotide Sequence

>693235 : length: 96
CGGGCCCCGGGCGGGCGGGAGGGACGGGACGCGGTGCAGTGTTGTTTTTTCCCCCGCCAA
TATTGCACTCGTCCCGGCCTCCGGCCCCCCCGGCCC

Protein Sequence

>693235 : length: 3
N/A