ONGene
Top
Scroll To Top
Gene information | Literature | Expression | lncRNA | Mutation | Homolog

Basic Information

Gene ID

693230

Name

MIR645

Synonym

MIRN645|hsa-mir-645;microRNA 645;MIR645;microRNA 645

Definition

-

Position

20q13.13

Gene Type

ncRNA

External Links

Links to cell senescence gene database

693230

Links to epithelial mesenchymal transition gene database

693230

Links to ovarian cancer gene database

693230

Links to endometrial cancer gene database

693230

Links to iHOP

693230

Sequence Information

Nucleotide Sequence

>693230 : length: 94
CAGTTCCTAACAGGCCTCAGACCAGTACCGGTCTGTGGCCTGGGGGTTGAGGACCCCTGC
TCTAGGCTGGTACTGCTGATGCTTAAAAAGAGAG

Protein Sequence

>693230 : length: 3
N/A