ONGene
Top
Scroll To Top
Gene information | Literature | Expression | lncRNA | Mutation | Homolog

Basic Information

Gene ID

693218

Name

MIR633

Synonym

MIRN633|hsa-mir-633;microRNA 633;MIR633;microRNA 633

Definition

-

Position

17q23.2

Gene Type

ncRNA

External Links

Links to cell senescence gene database

693218

Links to epithelial mesenchymal transition gene database

693218

Links to ovarian cancer gene database

693218

Links to endometrial cancer gene database

693218

Links to iHOP

693218

Sequence Information

Nucleotide Sequence

>693218 : length: 98
AACCTCTCTTAGCCTCTGTTTCTTTATTGCGGTAGATACTATTAACCTAAAATGAGAAGG
CTAATAGTATCTACCACAATAAAATTGTTGTGAGGATA

Protein Sequence

>693218 : length: 3
N/A