ONGene
Top
Scroll To Top
Gene information | Literature | Expression | lncRNA | Mutation | Homolog

Basic Information

Gene ID

693160

Name

MIR575

Synonym

MIRN575|hsa-mir-575;microRNA 575;MIR575;microRNA 575

Definition

-

Position

4q21.22

Gene Type

ncRNA

External Links

Links to cell senescence gene database

693160

Links to epithelial mesenchymal transition gene database

693160

Links to ovarian cancer gene database

693160

Links to endometrial cancer gene database

693160

Links to iHOP

693160

Sequence Information

Nucleotide Sequence

>693160 : length: 94
AATTCAGCCCTGCCACTGGCTTATGTCATGACCTTGGGCTACTCAGGCTGTCTGCACAAT
GAGCCAGTTGGACAGGAGCAGTGCCACTCAACTC

Protein Sequence

>693160 : length: 3
N/A