ONGene
Top
Scroll To Top
Gene information | Literature | Expression | lncRNA | Mutation | Homolog

Basic Information

Gene ID

693122

Name

MIR421

Synonym

MIRN421|hsa-mir-421;microRNA 421;MIR421;microRNA 421

Definition

-

Position

Xq13.2

Gene Type

ncRNA

External Links

Links to cell senescence gene database

693122

Links to epithelial mesenchymal transition gene database

693122

Links to ovarian cancer gene database

693122

Links to endometrial cancer gene database

693122

Links to iHOP

693122

Sequence Information

Nucleotide Sequence

>693122 : length: 85
GCACATTGTAGGCCTCATTAAATGTTTGTTGAATGAAAAAATGAATCATCAACAGACATT
AATTGGGCGCCTGCTCTGTGATCTC

Protein Sequence

>693122 : length: 3
N/A