ONGene
Top
Scroll To Top
Gene information | Literature | Expression | lncRNA | Mutation | Homolog

Basic Information

Gene ID

677885

Name

SNORA59A

Synonym

ACA59;small nucleolar RNA, H/ACA box 59A;SNORA59A;small nucleolar RNA, H/ACA box 59A

Definition

-

Position

1p36.21

Gene Type

snoRNA

External Links

Links to cell senescence gene database

677885

Links to epithelial mesenchymal transition gene database

677885

Links to ovarian cancer gene database

677885

Links to endometrial cancer gene database

677885

Links to iHOP

677885

Sequence Information

Nucleotide Sequence

>677885 : length: 152
GCCCAGGGTATGTTCACGGGGCGATGCTGCCCTCCCAGCTGGCCCATGGGTGACCCTGGG
AACATTAACTGCCTCACAACGTTTGTGCCTCAGTTACCCGTAGATGTAGTGAGGGTAACA
ATACTTACTCTCGTTGGTGATAAGGAACAGCT

Protein Sequence

>677885 : length: 3
N/A