ONGene
Top
Scroll To Top
Gene information | Literature | Expression | lncRNA | Mutation | Homolog

Basic Information

Gene ID

677823

Name

SNORA80E

Synonym

ACA42|SNORA42;small nucleolar RNA, H/ACA box 80E;SNORA80E;small nucleolar RNA, H/ACA box 80E

Definition

ACA42 snoRNA|small nucleolar RNA, H/ACA box 42

Position

1q22

Gene Type

snoRNA

External Links

Links to cell senescence gene database

677823

Links to epithelial mesenchymal transition gene database

677823

Links to ovarian cancer gene database

677823

Links to endometrial cancer gene database

677823

Links to iHOP

677823

Sequence Information

Nucleotide Sequence

>677823 : length: 134
TGGTAATGGATTTATGGTGGGTCCTTCTCTGTGGGCCTCTCATAGTGTACCCATGCCATA
GCAAATGGCAGCCTCGAACCATTGCCCAGTCCCCTTACCTGTGGGCTGTGAGCACTGAAG
GGGGTTGCACAGTG

Protein Sequence

>677823 : length: 3
N/A