ONGene
Top
Scroll To Top
Gene information | Literature | Expression | lncRNA | Mutation | Homolog

Basic Information

Gene ID

664613

Name

MIR544A

Synonym

MIR544|MIRN544|hsa-mir-544|hsa-mir-544a;microRNA 544a;MIR544A;microRNA 544a

Definition

microRNA 544

Position

-

Gene Type

ncRNA

External Links

Links to cell senescence gene database

664613

Links to epithelial mesenchymal transition gene database

664613

Links to ovarian cancer gene database

664613

Links to endometrial cancer gene database

664613

Links to iHOP

664613

Sequence Information

Nucleotide Sequence

>664613 : length: 91
ATTTTCATCACCTAGGGATCTTGTTAAAAAGCAGATTCTGATTCAGGGACCAAGATTCTG
CATTTTTAGCAAGTTCTCAAGTGATGCTAAT

Protein Sequence

>664613 : length: 3
N/A