ONGene
Top
Scroll To Top
Gene information | Literature | Expression | lncRNA | Mutation | Homolog

Basic Information

Gene ID

652995

Name

UCA1

Synonym

CUDR|LINC00178|NCRNA00178|UCAT1;urothelial cancer associated 1 (non-protein coding);UCA1;urothelial cancer associated 1 (non-protein coding)

Definition

cancer up-regulated drug resistant|long intergenic non-protein coding RNA 178

Position

19p13.12

Gene Type

ncRNA

External Links

Links to cell senescence gene database

652995

Links to epithelial mesenchymal transition gene database

652995

Links to ovarian cancer gene database

652995

Links to endometrial cancer gene database

652995

Links to iHOP

652995

Sequence Information

Nucleotide Sequence

>652995 : length: 2314
TGACATTCTTCTGGACAATGAGTCCCATCATCTCTCCACCATGCACCTTGTGACTCCCTC
CTCTGCTGACAACAGATAACCACCTTTAACTGTAACTTTCCACAGCCTACCCCAGCCCTA
TAAAGCTGCCCCTCTCCTATCTCCCTTCGCTGACTCTCTTTTCAGACTCAGCCCACTTGC
ACCCAAGTGAATTAACAGCCTTGTTGCTCACACAAAGCCTGTTTAGGTGGTCTTCTATAC
GGACATGCTTGACACTTGGTGCCAAAATCTGGGCCAGGGGGACTCCTTCGTGAGACCGGC
CCCCTGTCCTGGCCCTCATTCCGTGAAGAGATCCACCTGCGACCTCGGGTCCTCAGACCA
GCCCAAGGAACATCTCACCAATTTCAAATCGGATCTCCTCGGCTTAGTGGCTGAAGACTG
ATGCTGCCCGATCGCCTCAGAAGCCCCTTGGACCATCACAGATGCCGAGCTTCGGGTAAC
TCTTACGGTGGAGGATTCCCAGCCATATGAAGACACCCTAGCTGGACGATCAGTCCTTGT
CAAAAGTCTGACCCCTCAAACTCTACAGCCTCAATGGACCAGACCCTACCCGGTCATTTA
TAGCACACCAACTGCCGTCCATCTGCAGGACCCTCTCCATTGGGTTCACCATTCCAGAAT
AAAGCCATGCCCATCAGACAGCCAGCTTGATCTCTCCTCTTCCTCCTGGAAGCCACAAGA
TTAGGCCGAGAGCCGATCAGACAAACAACCTACAACCCTTAAGCTCCTGGCAGCGCCCAG
CCAAGGCCATGCTTCCATGCAACACTCCTTCCAAATGGCCATCCCAGCATGCTTCCAAGC
AGGCTTCATCCGTTCCTCTGGACCCTCATCTCTTAAGACCTGCCGCCTATAAAAAGGATT
ATATCTTGAGACCCTATCCTCTAAAATTTTTTCCACACCCAAAACAAAAAATCTCTGGGT
CAAAAGTCTAAAACGCTTAGGCTGGCAACCATCAGATCCTTGCCCATGGTGTCCTCAAGC
CTACTCTCATGAAATGGACAACAGTACACGCATATGGGGCCAGTTCCACATATTTGGCAA
CCAGACCAGCATCCAGGACAACACAAAGTATGTTGTTTGTTGTTAGAGGGCTTGGGACAT
TTCACTCTTTGCCAGCCTCAGCTTAATCCAGGAGACAAAGATTATTTTCCTTATTATCTC
TTCTGCATAGGATCTGCAATCAGAACTATTGAACTTCTCCATTCAGACCGCCACTCACAC
CTATGGGAAAAGGGTAATGTATCATCGGCTTAGCAACAGGGAATACTATTCGTATGATGG
AAAATGGGGACAAAAGGCTTTGGTACATAAAACATTATTCCTTCCTTGGCCTAAAAACTC
ATCGCCACCTACATTAAAGCTAATATGCCTGATTACTGTTTTTAGAGAACTTATTTTATT
AGGGCAGTTCCAAGCTCAAAAATACGCTAACTGGCACCTTGTTAGCTACATAAAAATGCA
CCCTAGACCCGAAACTTACTAGACTCATTATAAAATTTTCTTTAAGGTGTCCACGCAGTC
CCTGGTCACACTTGAAGCAGTCCGGAGAAATATCAGCCCTACCCCAGTAATCCCCAGAAG
GAACTTACACTTTTTTTTAATCTTTTCCTACAACTTCATATTTTATAAATAAAAAGACAA
AAATGTCAGGCCTGTGAGCTGAAGCTTAGCCATTGTAACCCCTGTGACCTGCACATATCC
GTCCAGGTGGCCTGCAGGAGCCAAGAAGTCTGGAGCAGCCGAAAAACCACAAAGAAGTGA
AACAGCCAGTTCCTGCCTTAACTAATTAACCCACCTTACGACATTCCACCATTATGACTT
GTCCACCATTATGACTTGTTCCTGCCCTGCCCCAACTGATCAATCAACCCTGTGACATTC
TTCTCCTGGACAATGAGTCCCATCATCTCTCCACCATGCACCTTGTGACCCCCTCCTCTG
CTGAGGATAACCACCTTTAACTGTAACTTTCCACGCCTACCCAAGCCCTATAAAGCTGCC
CCTCTCCTATCTCCCTTCACTGACTCTCTTTTCGGACTCAGCCCACTTGCACCCAAGTGA
ATTAACAGCCTTGTTGCTCACACAAAGCCTGATTGGGTGTCTTCTATACGGACACGCGTG
ACAGGAACCTCAACCCAAAGGCAGTCTGATGAGGTGTCTAAGATAAAAGTAGCGGCACAA
AGGCTTTTGTAAACAGAGGCGTTTCATGTGGTTTTCCTTTCCTTTCCTTATATGTGAAAA
GGTGACAGAAAAGAAATCTTCCTAAAAGAGTCAG

Protein Sequence

>652995 : length: 3
N/A