ONGene
Top
Scroll To Top
Gene information | Literature | Expression | lncRNA | Mutation | Homolog

Basic Information

Gene ID

619552

Name

MIR483

Synonym

MIRN483|hsa-mir-483;microRNA 483;MIR483;microRNA 483

Definition

-

Position

11p15.5

Gene Type

ncRNA

External Links

Links to cell senescence gene database

619552

Links to epithelial mesenchymal transition gene database

619552

Links to ovarian cancer gene database

619552

Links to endometrial cancer gene database

619552

Links to iHOP

619552

Sequence Information

Nucleotide Sequence

>619552 : length: 76
GAGGGGGAAGACGGGAGGAAAGAAGGGAGTGGTTCCATCACGCCTCCTCACTCCTCTCCT
CCCGTCTTCTCCTCTC

Protein Sequence

>619552 : length: 3
N/A