ONGene
Top
Scroll To Top
Gene information | Literature | Expression | lncRNA | Mutation | Homolog

Basic Information

Gene ID

5820

Name

PVT1

Synonym

LINC00079|NCRNA00079;Pvt1 oncogene (non-protein coding);PVT1;Pvt1 oncogene (non-protein coding)

Definition

Oncogene PVT-1 (MYC activator)|Pvt1 oncogene homolog, MYC activator|long intergenic non-protein coding RNA 79|plasmacytoma variant translocation 1|pvt-1 (murine) oncogene homolog, MYC activator

Position

8q24

Gene Type

ncRNA

External Links

Links to cell senescence gene database

5820

Links to epithelial mesenchymal transition gene database

5820

Links to ovarian cancer gene database

5820

Links to endometrial cancer gene database

5820

Links to iHOP

5820

Sequence Information

Nucleotide Sequence

>5820 : length: 1716
CTCAAGATGGCTGTGCCTGTCAGCTGCATGGAGCTTCGTTCAAGTATTTTCTGAGCCTGA
TGGATTTACAGTGATCTTCAGTGGTCTGGGGAATAACGCTGGTGGAACCATGCACTGGAA
TGACACACGCCCGGCACATTTCAGGATACTAAAAGTGGTTTTAAGGGAGGCTGTGGCTGA
ATGCCTCATGGATTCTTACAGCTTGGATGTCCATGGGGGACGAAGGACTGCAGCTGGCTG
AGAGGGTTGAGATCTCTGTTTACTTAGATCTCTGCCAACTTCCTTTGGGTCTCCCTATGG
AATGTAAGACCCCGACTCTTCCTGGTGAAGCATCTGATGCACGTTCCATCCGGCGCTCAG
CTGGGCTTGAGCTGACCATACTCCCTGGAGCCTTCTCCCGAGGTGCGCGGGTGACCTTGG
CACATACAGCCATCATGATGGTACTTTAAGTGGAGGCTGAATCATCTCCCCTTTGAGCTG
CTTGGCACGTGGCTCCCTTGGTGTTCCCCTTTTACTGCCAGGACACTGAGATTTGGAGAG
AGTCTCACTCTGTGGTCCAGGCTGAAGTACAGTGGCATGATCCCAGGTCACTGCAACCCC
CACCTCCCGGGTTCAAGTGATCCTCCTGCCTCAGCCTCCCGAGTAGCTGGTATTACAGGC
GTGTGCCACAAAGCCTGGCTAAGTTTTGTATTTTTAGTAGAGACGGGGTTTCACCATGTT
GGCCAGGTTGGTCTCGAACTCCTGACCTCAAGTGATCCACTCACTTTGGCCTTTCAACGT
GCTGGGATTACAGGCGAGAGTCACCGCACCCGGACGACTCTGACATTTTTGAAGAGTCCA
GAATCCTGTTACACCTGGGATTTAGGCACTTTCAATCTGAAAAAATACATATCCTTTCAG
CACTCTGGACGGACTTGAGAACTGTCCTTACGTGACCTAAAGCTGGAGTATTTTGAGATT
GGAGAATTAAGAGCCAGTCTTGGTGCTCTGTGTTCACCTGGTTCATCTGAGGAGCTGCAT
CTACCCTGCCCATGCCATAGATCCTGCCCTGTTTGCTTCTCCTGTTGCTGCTAGTGGACA
TGAGAAGGACAGAATAACGGGCTCCCAGATTCACAAGCCCCACCAAGAGGATCACCCCAG
GAACGCTTGGAGGCTGAGGAGTTCACTGAGGCTACTGCATCTTGAGACTCAGGATGAAGA
CCCAGCTTGGGGCTGTCAAAGAGGCCTGAAGAGGCAGAACACCCCAGAGGAGCCTGGGGC
CACCACCCAGCATCACTGTGGGAAAACGGCAGCAGGAAATGTCCTCTCGCCTGCGTGCTC
CACCTCGGTCCACGCCTTCCCTCCTTCTGGAAGCCTTGCCTGACCACTGGCCTGCCCCTT
CTATGGGAATCACTACTGACCTTGCAGCTTATTATAGACTTATATGTTTTTTGCATGTCT
GACACCCATGACTCCACCTGGACCTTATGGCTCCACCCAGAAGCAATTCAGCCCAACAGG
AGGACAGCTTCAACCCATTACGATTTCATCTCTGCCCCAACCACTCAGCAGCAAGCACCT
GTTACCTGTCCACCCCCACCCCTTCCCCCAAACTGCCTTTGAAAAATCCCTAACCTATGA
GCTTTGAATAAGATGAGTACGAACTTCATCGCCCACGTGGCGTGGCCGGCCTCGTGTCTA
TTAAATTCTTTTTCTACTAAAAAAAAAAAAAAAAAA

Protein Sequence

>5820 : length: 3
N/A