ONGene
Top
Scroll To Top
Gene information | Literature | Expression | lncRNA | Mutation | Homolog

Basic Information

Gene ID

574512

Name

MIR507

Synonym

MIRN507|hsa-mir-507;microRNA 507;MIR507;microRNA 507

Definition

-

Position

Xq27.3

Gene Type

ncRNA

External Links

Links to cell senescence gene database

574512

Links to epithelial mesenchymal transition gene database

574512

Links to ovarian cancer gene database

574512

Links to endometrial cancer gene database

574512

Links to iHOP

574512

Sequence Information

Nucleotide Sequence

>574512 : length: 94
GTGCTGTGTGTAGTGCTTCACTTCAAGAAGTGCCATGCATGTGTCTAGAAATATGTTTTG
CACCTTTTGGAGTGAAATAATGCACAACAGATAC

Protein Sequence

>574512 : length: 3
N/A