ONGene
Top
Scroll To Top
Gene information | Literature | Expression | lncRNA | Mutation | Homolog

Basic Information

Gene ID

574511

Name

MIR506

Synonym

MIRN506|hsa-mir-506;microRNA 506;MIR506;microRNA 506

Definition

-

Position

Xq27.3

Gene Type

ncRNA

External Links

Links to cell senescence gene database

574511

Links to epithelial mesenchymal transition gene database

574511

Links to ovarian cancer gene database

574511

Links to endometrial cancer gene database

574511

Links to iHOP

574511

Sequence Information

Nucleotide Sequence

>574511 : length: 124
GCCACCACCATCAGCCATACTATGTGTAGTGCCTTATTCAGGAAGGTGTTACTTAATAGA
TTAATATTTGTAAGGCACCCTTCTGAGTAGAGTAATGTGCAACATGGACAACATTTGTGG
TGGC

Protein Sequence

>574511 : length: 3
N/A