ONGene
Top
Scroll To Top
Gene information | Literature | Expression | lncRNA | Mutation | Homolog

Basic Information

Gene ID

574510

Name

MIR513A2

Synonym

MIRN513-2|MIRN513A-2|MIRN513A2|hsa-mir-513a-2;microRNA 513a-2;MIR513A2;microRNA 513a-2

Definition

hsa-mir-513-2|microRNA 513-2

Position

Xq27.3

Gene Type

ncRNA

External Links

Links to cell senescence gene database

574510

Links to epithelial mesenchymal transition gene database

574510

Links to ovarian cancer gene database

574510

Links to endometrial cancer gene database

574510

Links to iHOP

574510

Sequence Information

Nucleotide Sequence

>574510 : length: 127
GGATGCCACATTCAGCCATTCAGTGTGCAGTGCCTTTCACAGGGAGGTGTCATTTATGTG
AACTAAAATATAAATTTCACCTTTCTGAGAAGGGTAATGTACAGCATGCACTGCATATGT
GGTGTCC

Protein Sequence

>574510 : length: 3
N/A