ONGene
Top
Scroll To Top
Gene information | Literature | Expression | lncRNA | Mutation | Homolog

Basic Information

Gene ID

574492

Name

MIR517C

Synonym

MIRN517C;microRNA 517c;MIR517C;microRNA 517c

Definition

hsa-mir-517c

Position

19q13.42

Gene Type

ncRNA

External Links

Links to cell senescence gene database

574492

Links to epithelial mesenchymal transition gene database

574492

Links to ovarian cancer gene database

574492

Links to endometrial cancer gene database

574492

Links to iHOP

574492

Sequence Information

Nucleotide Sequence

>574492 : length: 95
GAAGATCTCAGGCAGTGACCCTCTAGATGGAAGCACTGTCTGTTGTCTAAGAAAAGATCG
TGCATCCTTTTAGAGTGTTACTGTTTGAGAAAATC

Protein Sequence

>574492 : length: 3
N/A