ONGene
Top
Scroll To Top
Gene information | Literature | Expression | lncRNA | Mutation | Homolog

Basic Information

Gene ID

574484

Name

MIR520G

Synonym

MIRN520G;microRNA 520g;MIR520G;microRNA 520g

Definition

hsa-mir-520g

Position

19q13.42

Gene Type

ncRNA

External Links

Links to cell senescence gene database

574484

Links to epithelial mesenchymal transition gene database

574484

Links to ovarian cancer gene database

574484

Links to endometrial cancer gene database

574484

Links to iHOP

574484

Sequence Information

Nucleotide Sequence

>574484 : length: 90
TCCCATGCTGTGACCCTCTAGAGGAAGCACTTTCTGTTTGTTGTCTGAGAAAAAACAAAG
TGCTTCCCTTTAGAGTGTTACCGTTTGGGA

Protein Sequence

>574484 : length: 3
N/A