ONGene
Top
Scroll To Top
Gene information | Literature | Expression | lncRNA | Mutation | Homolog

Basic Information

Gene ID

574479

Name

MIR517A

Synonym

MIRN517A;microRNA 517a;MIR517A;microRNA 517a

Definition

hsa-mir-517a

Position

19q13.42

Gene Type

ncRNA

External Links

Links to cell senescence gene database

574479

Links to epithelial mesenchymal transition gene database

574479

Links to ovarian cancer gene database

574479

Links to endometrial cancer gene database

574479

Links to iHOP

574479

Sequence Information

Nucleotide Sequence

>574479 : length: 87
TCTCAGGCAGTGACCCTCTAGATGGAAGCACTGTCTGTTGTATAAAAGAAAAGATCGTGC
ATCCCTTTAGAGTGTTACTGTTTGAGA

Protein Sequence

>574479 : length: 3
N/A