ONGene
Top
Scroll To Top
Gene information | Literature | Expression | lncRNA | Mutation | Homolog

Basic Information

Gene ID

574468

Name

MIR526B

Synonym

MIRN526B;microRNA 526b;MIR526B;microRNA 526b

Definition

hsa-mir-526b

Position

19q13.42

Gene Type

ncRNA

External Links

Links to cell senescence gene database

574468

Links to epithelial mesenchymal transition gene database

574468

Links to ovarian cancer gene database

574468

Links to endometrial cancer gene database

574468

Links to iHOP

574468

Sequence Information

Nucleotide Sequence

>574468 : length: 83
TCAGGCTGTGACCCTCTTGAGGGAAGCACTTTCTGTTGTCTGAAAGAAGAGAAAGTGCTT
CCTTTTAGAGGCTTACTGTCTGA

Protein Sequence

>574468 : length: 3
N/A