ONGene
Top
Scroll To Top
Gene information | Literature | Expression | lncRNA | Mutation | Homolog

Basic Information

Gene ID

574447

Name

MIR146B

Synonym

MIRN146B|miRNA146B;microRNA 146b;MIR146B;microRNA 146b

Definition

hsa-mir-146b

Position

10q24.32

Gene Type

ncRNA

External Links

Links to cell senescence gene database

574447

Links to epithelial mesenchymal transition gene database

574447

Links to ovarian cancer gene database

574447

Links to endometrial cancer gene database

574447

Links to iHOP

574447

Sequence Information

Nucleotide Sequence

>574447 : length: 73
CCTGGCACTGAGAACTGAATTCCATAGGCTGTGAGCTCTAGCAATGCCCTGTGGACTCAG
TTCTGGTGCCCGG

Protein Sequence

>574447 : length: 3
N/A