ONGene
Top
Scroll To Top
Gene information | Literature | Expression | lncRNA | Mutation | Homolog

Basic Information

Gene ID

574436

Name

MIR485

Synonym

MIRN485|hsa-mir-485;microRNA 485;MIR485;microRNA 485

Definition

-

Position

14q32.31

Gene Type

ncRNA

External Links

Links to cell senescence gene database

574436

Links to epithelial mesenchymal transition gene database

574436

Links to ovarian cancer gene database

574436

Links to endometrial cancer gene database

574436

Links to iHOP

574436

Sequence Information

Nucleotide Sequence

>574436 : length: 73
ACTTGGAGAGAGGCTGGCCGTGATGAATTCGATTCATCAAAGCGAGTCATACACGGCTCT
CCTCTCTTTTAGT

Protein Sequence

>574436 : length: 3
N/A