ONGene
Top
Scroll To Top
Gene information | Literature | Expression | lncRNA | Mutation | Homolog

Basic Information

Gene ID

574032

Name

MIR20B

Synonym

MIRN20B|hsa-mir-20b;microRNA 20b;MIR20B;microRNA 20b

Definition

-

Position

Xq26.2

Gene Type

ncRNA

External Links

Links to cell senescence gene database

574032

Links to epithelial mesenchymal transition gene database

574032

Links to ovarian cancer gene database

574032

Links to endometrial cancer gene database

574032

Links to iHOP

574032

Sequence Information

Nucleotide Sequence

>574032 : length: 69
AGTACCAAAGTGCTCATAGTGCAGGTAGTTTTGGCATGACTCTACTGTAGTATGGGCACT
TCCAGTACT

Protein Sequence

>574032 : length: 3
N/A