ONGene
Top
Scroll To Top
Gene information | Literature | Expression | lncRNA | Mutation | Homolog

Basic Information

Gene ID

494335

Name

MIR423

Synonym

MIRN423|hsa-mir-423;microRNA 423;MIR423;microRNA 423

Definition

-

Position

17q11.2

Gene Type

ncRNA

External Links

Links to cell senescence gene database

494335

Links to epithelial mesenchymal transition gene database

494335

Links to ovarian cancer gene database

494335

Links to endometrial cancer gene database

494335

Links to iHOP

494335

Sequence Information

Nucleotide Sequence

>494335 : length: 94
ATAAAGGAAGTTAGGCTGAGGGGCAGAGAGCGAGACTTTTCTATTTTCCAAAAGCTCGGT
CTGAGGCCCCTCAGTCTTGCTTCCTAACCCGCGC

Protein Sequence

>494335 : length: 3
N/A