ONGene
Top
Scroll To Top
Gene information | Literature | Expression | lncRNA | Mutation | Homolog

Basic Information

Gene ID

494329

Name

MIR380

Synonym

MIR380-3p|MIRN380|hsa-mir-380;microRNA 380;MIR380;microRNA 380

Definition

-

Position

14q32.31

Gene Type

ncRNA

External Links

Links to cell senescence gene database

494329

Links to epithelial mesenchymal transition gene database

494329

Links to ovarian cancer gene database

494329

Links to endometrial cancer gene database

494329

Links to iHOP

494329

Sequence Information

Nucleotide Sequence

>494329 : length: 61
AAGATGGTTGACCATAGAACATGCGCTATCTCTGTGTCGTATGTAATATGGTCCACATCT
T

Protein Sequence

>494329 : length: 3
N/A