ONGene
Top
Scroll To Top
Gene information | Literature | Expression | lncRNA | Mutation | Homolog

Basic Information

Gene ID

442919

Name

MIR374A

Synonym

MIRN374|MIRN374A|hsa-mir-374;microRNA 374a;MIR374A;microRNA 374a

Definition

hsa-mir-374a|microRNA 374

Position

Xq13.2

Gene Type

ncRNA

External Links

Links to cell senescence gene database

442919

Links to epithelial mesenchymal transition gene database

442919

Links to ovarian cancer gene database

442919

Links to endometrial cancer gene database

442919

Links to iHOP

442919

Sequence Information

Nucleotide Sequence

>442919 : length: 72
TACATCGGCCATTATAATACAACCTGATAAGTGTTATAGCACTTATCAGATTGTATTGTA
ATTGTCTGTGTA

Protein Sequence

>442919 : length: 3
N/A