ONGene
Top
Scroll To Top
Gene information | Literature | Expression | lncRNA | Mutation | Homolog

Basic Information

Gene ID

442918

Name

MIR373

Synonym

MIRN373|hsa-mir-373|miRNA373;microRNA 373;MIR373;microRNA 373

Definition

-

Position

19q13.42

Gene Type

ncRNA

External Links

Links to cell senescence gene database

442918

Links to epithelial mesenchymal transition gene database

442918

Links to ovarian cancer gene database

442918

Links to endometrial cancer gene database

442918

Links to iHOP

442918

Sequence Information

Nucleotide Sequence

>442918 : length: 69
GGGATACTCAAAATGGGGGCGCTTTCCTTTTTGTCTGTACTGGGAAGTGCTTCGATTTTG
GGGTGTCCC

Protein Sequence

>442918 : length: 3
N/A