ONGene
Top
Scroll To Top
Gene information | Literature | Expression | lncRNA | Mutation | Homolog

Basic Information

Gene ID

442917

Name

MIR372

Synonym

MIRN372|hsa-mir-372;microRNA 372;MIR372;microRNA 372

Definition

-

Position

19q13.42

Gene Type

ncRNA

External Links

Links to cell senescence gene database

442917

Links to epithelial mesenchymal transition gene database

442917

Links to ovarian cancer gene database

442917

Links to endometrial cancer gene database

442917

Links to iHOP

442917

Sequence Information

Nucleotide Sequence

>442917 : length: 67
GTGGGCCTCAAATGTGGAGCACTATTCTGATGTCCAAGTGGAAAGTGCTGCGACATTTGA
GCGTCAC

Protein Sequence

>442917 : length: 3
N/A