ONGene
Top
Scroll To Top
Gene information | Literature | Expression | lncRNA | Mutation | Homolog

Basic Information

Gene ID

442904

Name

MIR335

Synonym

MIRN335|hsa-mir-335|miRNA335;microRNA 335;MIR335;microRNA 335

Definition

-

Position

7q32.2

Gene Type

ncRNA

External Links

Links to cell senescence gene database

442904

Links to epithelial mesenchymal transition gene database

442904

Links to ovarian cancer gene database

442904

Links to endometrial cancer gene database

442904

Links to iHOP

442904

Sequence Information

Nucleotide Sequence

>442904 : length: 94
TGTTTTGAGCGGGGGTCAAGAGCAATAACGAAAAATGTTTGTCATAAACCGTTTTTCATT
ATTGCTCCTGACCTCCTCTCATTTGCTATATTCA

Protein Sequence

>442904 : length: 3
N/A