ONGene
Top
Scroll To Top
Gene information | Literature | Expression | lncRNA | Mutation | Homolog

Basic Information

Gene ID

442902

Name

MIR330

Synonym

MIRN330|hsa-mir-330;microRNA 330;MIR330;microRNA 330

Definition

-

Position

19q13.32

Gene Type

ncRNA

External Links

Links to cell senescence gene database

442902

Links to epithelial mesenchymal transition gene database

442902

Links to ovarian cancer gene database

442902

Links to endometrial cancer gene database

442902

Links to iHOP

442902

Sequence Information

Nucleotide Sequence

>442902 : length: 94
CTTTGGCGATCACTGCCTCTCTGGGCCTGTGTCTTAGGCTCTGCAAGATCAACCGAGCAA
AGCACACGGCCTGCAGAGAGGCAGCGCTCTGCCC

Protein Sequence

>442902 : length: 3
N/A