ONGene
Top
Scroll To Top
Gene information | Literature | Expression | lncRNA | Mutation | Homolog

Basic Information

Gene ID

442893

Name

MIR151A

Synonym

MIR151|MIRN151|hsa-mir-151|hsa-mir-151a;microRNA 151a;MIR151A;microRNA 151a

Definition

microRNA 151

Position

-

Gene Type

ncRNA

External Links

Links to cell senescence gene database

442893

Links to epithelial mesenchymal transition gene database

442893

Links to ovarian cancer gene database

442893

Links to endometrial cancer gene database

442893

Links to iHOP

442893

Sequence Information

Nucleotide Sequence

>442893 : length: 90
TTTCCTGCCCTCGAGGAGCTCACAGTCTAGTATGTCTCATCCCCTACTAGACTGAAGCTC
CTTGAGGACAGGGATGGTCATACTCACCTC

Protein Sequence

>442893 : length: 3
N/A