ONGene
Top
Scroll To Top
Gene information | Literature | Expression | lncRNA | Mutation | Homolog

Basic Information

Gene ID

442891

Name

MIR135B

Synonym

MIRN135B;microRNA 135b;MIR135B;microRNA 135b

Definition

hsa-mir-135b

Position

1q32.1

Gene Type

ncRNA

External Links

Links to cell senescence gene database

442891

Links to epithelial mesenchymal transition gene database

442891

Links to ovarian cancer gene database

442891

Links to endometrial cancer gene database

442891

Links to iHOP

442891

Sequence Information

Nucleotide Sequence

>442891 : length: 97
CACTCTGCTGTGGCCTATGGCTTTTCATTCCTATGTGATTGCTGTCCCAAACTCATGTAG
GGCTAAAAGCCATGGGCTACAGTGAGGGGCGAGCTCC

Protein Sequence

>442891 : length: 3
N/A