ONGene
Top
Scroll To Top
Gene information | Literature | Expression | lncRNA | Mutation | Homolog

Basic Information

Gene ID

442890

Name

MIR133B

Synonym

MIRN133B|miRNA133B|mir-133b;microRNA 133b;MIR133B;microRNA 133b

Definition

hsa-mir-133b

Position

6p12.2

Gene Type

ncRNA

External Links

Links to cell senescence gene database

442890

Links to epithelial mesenchymal transition gene database

442890

Links to ovarian cancer gene database

442890

Links to endometrial cancer gene database

442890

Links to iHOP

442890

Sequence Information

Nucleotide Sequence

>442890 : length: 119
CCTCAGAAGAAAGATGCCCCCTGCTCTGGCTGGTCAAACGGAACCAAGTCCGTCTTCCTG
AGAGGTTTGGTCCCCTTCAACCAGCTACAGCAGGGCTGGCAATGCCCAGTCCTTGGAGA

Protein Sequence

>442890 : length: 3
N/A