ONGene
Top
Scroll To Top
Gene information | Literature | Expression | lncRNA | Mutation | Homolog

Basic Information

Gene ID

441951

Name

ZFAS1

Synonym

C20orf199|HSUP1|HSUP2|NCRNA00275|ZNFX1-AS1;ZNFX1 antisense RNA 1;ZFAS1;ZNFX1 antisense RNA 1

Definition

Putative uncharacterized protein ZNFX1-AS1|ZNFX1 antisense RNA 1 (non-protein coding)|ZNFX1 antisense gene protein 1

Position

20q13.13

Gene Type

ncRNA

External Links

Links to cell senescence gene database

441951

Links to epithelial mesenchymal transition gene database

441951

Links to ovarian cancer gene database

441951

Links to endometrial cancer gene database

441951

Links to iHOP

441951

Sequence Information

Nucleotide Sequence

>441951 : length: 1020
CGGGGGCCCAGGGTGGAGAGCACGAGGGCCTGGCCCAGGCACGGCCGGCGCCTCCGCCCT
CGAGGAGGGCGTCACCTCAGCTCCCCCCGGCGGCGGAGCCGGCGGGCTCAGGCGGGCGCG
GCTGAGGGGAGCGGACCGCGGGGGGCGGGAGATGACTGCGCCCAAGGCCTTTGCGGGCCT
CAGCCGGCCCCAGAGGAAGGGGAACCCGTCGAGCGGTTTGGTGCGTGTGAAGCGCGACAT
GGCGAGGAAGCGGACAAGCCCGGGTGGCCCGGCGTGTAGAGGGAAGGGGGCGGGGCTAGA
CGCGGCCTGGACAACTACTAGAGCGCCTCGGGCTGTGCTGCTCGAGACTACATTTCCCAG
AGCGACGCGCGCGGAGCGGGCGGGAAAGAGAGCGTTTCGGGTCCAGTGCGCAGGTGCGAA
AGCCATCTTTGGTTATATAAGGGAGGTTCAGGAAGCCATTCGTTCTTTCGCGTCTGCGGT
GCCCGGAGTGTGGTACTTCTCCTAGTTGCAGTCAGGCTTCATACGCTATTGTCCTGCCCG
TTAGAGCAGCCAGCGGGTACAGAATGGATTTTGGAAGAGGGAGTCACCACTGGACCTCCA
AGGAAGCCACGTGCAGACATCTACAACCTTCGATCTCCTGACGAGTTTATTGTTGGCCAA
AACCAGGCTTTGATTGAACCAGGATGAATGCGGGTGTTGGAAGTAGAATATATATATACA
TATAAAATTGGTTGGGAGCCACGTGTACCAGTGTGTGTTGATCTTGGCTTGATTCAGTCT
GCCTTGTAACAGAAACTGGCGATGGAATATGAGAGGAGCCCTCTGGAAAGAAAAGGACAG
ACCCTGTGCTTTCATGAAAGTGAAGATCTGGCTGAACCAGTTCCACAAGGTTACTGTATA
CATAGCCTGAGTTTAAAAGGCTGTGCCCACTTCAAGAATGTCATTGTTAGACTTTGAAAT
TTCTAACTGCCTACCTGCATAAAGAAAATAAAATCTTTTAAATCAAAAAAAAAAAAAAAA

Protein Sequence

>441951 : length: 3
N/A