ONGene
Top
Scroll To Top
Gene information | Literature | Expression | lncRNA | Mutation | Homolog

Basic Information

Gene ID

407975

Name

MIR17HG

Synonym

C13orf25|FGLDS2|LINC00048|MIHG1|MIRH1|MIRHG1|NCRNA00048|miR-17-92;miR-17-92 cluster host gene;MIR17HG;miR-17-92 cluster host gene

Definition

MIR17 host gene (non-protein coding)|long intergenic non-protein coding RNA 48|miR-17-92 cluster host gene (non-protein coding)|microRNA host gene (non-protein coding) 1|microRNA host gene 1 (non-protein coding)|mir-17-92 microRNA cluster

Position

13q31.3

Gene Type

ncRNA

External Links

Links to cell senescence gene database

407975

Links to epithelial mesenchymal transition gene database

407975

Links to ovarian cancer gene database

407975

Links to endometrial cancer gene database

407975

Links to iHOP

407975

Sequence Information

Nucleotide Sequence

>407975 : length: 5018
GAAGCTCTCCTCGCGGGGCGGGCCGGCCGGCCGCACCCCCGGCCTGGGGCCTCCGGTCGT
AGTAAAGCGCAGGCGGGCGGGGAGGCGGGAGCAGGAGCCCGCGGCCGGCCAGCCGAAGAT
GGTGGCGGCTACTCCTCCTGTCATACACGTGGACCTAACTGCACCAGTAGCTTTTCTGAG
AATACTTGCTGAAAAGGAAGTTTTCTGGAATGGGTAAGTGTATTCTGATTTTCTTGAACT
TTTCTTAAAAACAAATTTTTCTTGCTATTAAAGTTGAATAAATAGGATTGGTTTCTTAGA
GAGTAAAAGTAGGTGTTTCTTTCTTTAGACAATGTACCTTTTCTGAAAAACTAACTCATT
AAGTACGGATTTGCTAATTTTAAGGTAGTAAAATTACAGTGTAAATATTCCTGTACATTT
TTGGAAACTGGCTTATGCAGTTTACGAAATATAATTTTAGACCCTCTTTTAAGTTGGGTG
ATAAAGTAGATATAACCTGAGATGATAGATTTAAACAGGATATTTACGTTCTGCTACAAT
TGACTGATAACACTTGAAGTGTAGTCTGAACAGTAATTTTGTTAATCATTTCAACAAGTA
TTTGCTAAGTGGAAGCCAGAAGAGGAGGAAAATGTTTTGCCACGTGGATGTGAAGATTTC
CTCTAAAAGGTACACATGGACTAAATTGCCTTTAAATGTTCCAAAATTAGTTCTCATTTA
TTTGCAGTCTCATTTTGTTTTGTTTTTTTTCTCTATGTGTCAATCCATTTGGGAGAGGCC
AGCCATTGGAAGAGCCACCACTTCCAGTGCTAGTTGGATGGTTGGTTATGATTGCCTTCT
GTAAAGAATTCTTAAGGCATAAATACGTGTCTAAATGGACCTCATATCTTTGAGATAATT
AAACTAATTTTTTCTTCCCCATTAGGGATTATGCTGAATTTGTATGGTTTATAGTTGTTA
GAGTTTGAGGTGTTAATTCTAATTATCTATTTCAAATTTAGCAGGAAAAAAGAGAACATC
ACCTTGTAAAACTGAAGATTGTGACCAGTCAGAATAATGTCAAAGTGCTTACAGTGCAGG
TAGTGATATGTGCATCTACTGCAGTGAAGGCACTTGTAGCATTATGGTGACAGCTGCCTC
GGGAAGCCAAGTTGGGCTTTAAAGTGCAGGGCCTGCTGATGTTGAGTGCTTTTTGTTCTA
AGGTGCATCTAGTGCAGATAGTGAAGTAGATTAGCATCTACTGCCCTAAGTGCTCCTTCT
GGCATAAGAAGTTATGTATTCATCCAATAATTCAAGCCAAGCAAGTATATAGGTGTTTTA
ATAGTTTTTGTTTGCAGTCCTCTGTTAGTTTTGCATAGTTGCACTACAAGAAGAATGTAG
TTGTGCAAATCTATGCAAAACTGATGGTGGCCTGCTATTTCCTTCAAATGAATGATTTTT
ACTAATTTTGTGTACTTTTATTGTGTCGATGTAGAATCTGCCTGGTCTATCTGATGTGAC
AGCTTCTGTAGCACTAAAGTGCTTATAGTGCAGGTAGTGTTTAGTTATCTACTGCATTAT
GAGCACTTAAAGTACTGCTAGCTGTAGAACTCCAGCTTCGGCCTGTCGCCCAATCAAACT
GTCCTGTTACTGAACACTGTTCTATGGTTAGTTTTGCAGGTTTGCATCCAGCTGTGTGAT
ATTCTGCTGTGCAAATCCATGCAAAACTGACTGTGGTAGTGAAAAGTCTGTAGAAAAGTA
AGGGAAACTCAAACCCCTTTCTACACAGGTTGGGATCGGTTGCAATGCTGTGTTTCTGTA
TGGTATTGCACTTGTCCCGGCCTGTTGAGTTTGGTGGGGATTGTGACCAGAAGATTTTGA
AAATTAAATATTACTGAAGATTTCGACTTCCACTGTTAAATGTACAAGATACATGAAATA
TTAAAGAAAATGTGTAACTTTTTGTGTAAATACATCTTGTCTTGTTTTCATTCAAAAACA
TTTCACTTTTGGGGTTGCGTGTCAGATTTGGCAGTATAAATTCTGGCTATATTTTTTGTT
GTTAGATTTATTTGGCTGTTAAGTATTGCGATATGACTAAACATACTGTATACCTGATGA
TCATCTGTAAAGTTAGAGTATATCTTTTTGCTTTCTTTGGAGTTAGTGTTATTCCAGGAT
ATTTTACTTAATCTAAAAGTTAATTTATGTTGCTCATATATTACTCAAGTATTTAAATTT
AGAGAGAATGCCGCTCTGTTTAAAGCAATGTGTAAAGATGAGTTTTTTTAAGCATGGAAT
TTAGGGTTGGGGTACAATTTGTTTCTATTAAGCAAGTACCAGTTTACCAATACATGAGTA
ACTGAAGTGTAACTGTTAAATGCTTGTATACTAGTTTTTCTTTCTGATTGTCAGTGATTT
ATAAGCTATAAATGACCAAGGTCCTCAGACTGCTTTTAGCATCTGCAACTTAAAAAAATG
GGAGTTAGAAAAAGAACAAATGCTAAATAGAGTAACAGTTAAATGTATGTGTACACTCTT
CCCAAATGCCAAGAGTGCAGCGGTGGGGTGAGATTCAGATATTCATTTATTTCTAAGTCT
GTAGTTAACATTTATGTTCCCTACTCCCTACGTAAGCCAGACTTTGGCAACAGTGATAGT
TGATTCCAGGCTTATTTGACTTAAAGTCACTGAAGTGGAAACTAAGAAGTGGCAGTTAGT
GTTTTACCCAGCATTTCTGCCTTCTCTCTTTTCTTCATGTGTTTTTGTCTCTAGCCTATG
TGTATTTGTGTAGAATAATGTGGGATACCTGAATAATAGATTTAAAAGGACCAAGTGGTA
AAATTGGGCCCAAGCTGAAGTACAGGCAAACTTGATGTTTGAAAGATAAGTTTTGAGAAA
TGTCATTGTATTTTGGAGTAAAAGAGGCTATCTTAGTAATAAGAAATAAACTTCCATAAC
ACTAGGTTAGACCACCCAATAAATCTAGAAATCAGCTTTTAAAAATATTGTCTGAAGTCT
AACAAAAGTTTTCACCTCTAATGTGTTCTTTAAGAAATTTAAGGAACTTAGCCTTGGATT
CCTGAATAGAAAGGTAAGAATTCTATCATTCTGGAGTTGATGAAAACATAAATTTTCAGG
ATGTGAAATGAACAGTGATTTATAAAATGGAAATCAAATTGTACATTAGCAGAGTTCTTA
AGCTTTTTGAATTGAAGGAGACCTAATAATTGTGTCTTTTTGGTTATTTAGTGACAAACG
TGGCTTTCAAACTATGCTTAAAAAGTTCCGGCTGGACACGGTGGCTCACACCTATAATCC
TAGCACTTGGGGAGGCTGAGGCAGACGGATTACCTGAGGTCAGGAGTTCGAGACCAACCT
GGCCGACATGGTGAAACGCTGTCTCTACTAAAAATATAAAAAATTAGCCGGGTGCAGTGG
CGTGCACCTGTAATCCCAGCTACTCTGGAGGCTGAGGCAGGAGAATCACCTGAACCTGGG
AGGTGGAGGTTTCAGTGAGCTGAGATCCTGCCACTGCACTCCAGCCTGGGCGCAAGACCA
AGACTTAAACGCAAAAAAAAAAAAAAAAAAAAAAAAAAAGTTTCATAATACAGCATGGTC
TGGTAGTTTGCAAAATGGTGTGCTTTTGGGGAGATACACTAGCAATTTTTTTAAAAACTG
GAACAGTGTGATAGGAAGCCTGCTGGATGATTTCTTAAATATTCTAAAATGTAAGTCAAA
TATGTTTTAATAACAAAGACTTAAATGGCTTTTCTCCCTAGAGACTGAAACTAGTATTCA
TTGTGTTCAGAACTTAATTGGGCTTGAACTGAGATTTAAATCTAATAAACAAGTTAATAA
ATGTGTATGTTTTGTTGTGGGTTTGGTAGTGATCTGTGGTTCTATAGGGTTTAATAGGAA
TTGCTTTTGATTTGTTTCTGGCTTTAGAATGTGAGGCAAATTTTACATTCTTGGTTCTAT
TAAGATTTTCTTAGGCATGCTAACATGCCAACAAAAAGCCATGTAAGTATTGTATAAAAA
GATTCACATTGTTAATTTAGCCATTTTGAAATTCAGATGAGTGAGCAAGTTGATAATGGC
CTCATCTCTGACCTGAGAAAAAACAACTTTGACCCTTGTTCTTAAAATGCTTTAACCTTG
AAGTTGCTTGAGACTTAAGAGGTCATGTTGCTTTAGGTTTAATAAATAGCCTTAACTATT
TGGAGGGGAAAAAATGGGTCAACTTTTTTTTTTTTTTTTGGCGTTTGCATGTACAACTTT
CTATTTTTAGCCTATATTTGGAAAGAAAGCACTTAACATTTTAGGAATTCTTTTTAAAGC
TGCTTGCAAAGTGTTGGTGATTTTACTGAAAACTTTTGAGATCTTCATTTTACAGGCAGA
CCTGTCTAACTACAAGCCAGACTTGGGTTTTCTCCTGTAGTTTGAAGACACACTGACTCC
TGACAAAATGCAGCCTGCAACTTCCTGGAGAACAACTCAGTGTCACATTAAAGTTTATTA
TGTATTTAATGATACACTGTTTAATTGACAGTTTTGCATAGTTTGTCTAACTTTAGAGAA
TTAAGAGCCTCTCAACTGAGCAGTAAAGGTAAGGAGAGCTCAATCTGCACAGAGCCAGTT
TTTAGTGTTTGATGGAAATAAGATCATCATGCCCACTTGAGACTTCAGATTATTCTTTAG
CTTAGTGGTTGTATGAGTTACATCTTATTAAAGTCGAAATTAATGTAGTTTTCTGCCTTG
ATAACATTTCATATGTGGTATTAGTTTTAAAGGGTCATTAGGAAAATGCACATATTCCAT
GAATTTTAAGACCCATAGAAAAGTTGAAGAATGCTTAATTTTCTTATCCAGTAATGTAAA
CACAGAGACAGAACATTGAGATGTGCCTAGTTCTGTATTTACAGTTTGGTCTGGCTGTTT
GAGTTCTAGCGCATTTAATGTTAATAAATAAAATACTGCATTTTAAAGCTGTTAAGAAAT
TGTCCAGAACGAGAATATTGAAATAAAAACTTCAAGGT

Protein Sequence

>407975 : length: 3
N/A