ONGene
Top
Scroll To Top
Gene information | Literature | Expression | lncRNA | Mutation | Homolog

Basic Information

Gene ID

407053

Name

MIR96

Synonym

DFNA50|MIRN96|hsa-mir-96|miR-96|miRNA96;microRNA 96;MIR96;microRNA 96

Definition

-

Position

7q32.2

Gene Type

ncRNA

External Links

Links to cell senescence gene database

407053

Links to epithelial mesenchymal transition gene database

407053

Links to ovarian cancer gene database

407053

Links to endometrial cancer gene database

407053

Links to iHOP

407053

Sequence Information

Nucleotide Sequence

>407053 : length: 78
TGGCCGATTTTGGCACTAGCACATTTTTGCTTGTGTCTCTCCGCTCTGAGCAATCATGTG
CAGTGCCAATATGGGAAA

Protein Sequence

>407053 : length: 3
N/A