ONGene
Top
Scroll To Top
Gene information | Literature | Expression | lncRNA | Mutation | Homolog

Basic Information

Gene ID

407052

Name

MIR95

Synonym

MIRN95|hsa-mir-95|miR-95;microRNA 95;MIR95;microRNA 95

Definition

-

Position

-

Gene Type

ncRNA

External Links

Links to cell senescence gene database

407052

Links to epithelial mesenchymal transition gene database

407052

Links to ovarian cancer gene database

407052

Links to endometrial cancer gene database

407052

Links to iHOP

407052

Sequence Information

Nucleotide Sequence

>407052 : length: 81
AACACAGTGGGCACTCAATAAATGTCTGTTGAATTGAAATGCGTTACATTCAACGGGTAT
TTATTGAGCACCCACTCTGTG

Protein Sequence

>407052 : length: 3
N/A