ONGene
Top
Scroll To Top
Gene information | Literature | Expression | lncRNA | Mutation | Homolog

Basic Information

Gene ID

407050

Name

MIR93

Synonym

MIRN9|MIRN93|hsa-mir-93|miR-93;microRNA 93;MIR93;microRNA 93

Definition

-

Position

7q22.1

Gene Type

ncRNA

External Links

Links to cell senescence gene database

407050

Links to epithelial mesenchymal transition gene database

407050

Links to ovarian cancer gene database

407050

Links to endometrial cancer gene database

407050

Links to iHOP

407050

Sequence Information

Nucleotide Sequence

>407050 : length: 80
CTGGGGGCTCCAAAGTGCTGTTCGTGCAGGTAGTGTGATTACCCAACCTACTGCTGAGCT
AGCACTTCCCGAGCCCCCGG

Protein Sequence

>407050 : length: 3
N/A