ONGene
Top
Scroll To Top
Gene information | Literature | Expression | lncRNA | Mutation | Homolog

Basic Information

Gene ID

407048

Name

MIR92A1

Synonym

MIR92-1|MIRN92-1|MIRN92A-1|MIRN92A1|miRNA92-1;microRNA 92a-1;MIR92A1;microRNA 92a-1

Definition

hsa-mir-92-1|hsa-mir-92a-1|microRNA 92-1

Position

13q31.3

Gene Type

ncRNA

External Links

Links to cell senescence gene database

407048

Links to epithelial mesenchymal transition gene database

407048

Links to ovarian cancer gene database

407048

Links to endometrial cancer gene database

407048

Links to iHOP

407048

Sequence Information

Nucleotide Sequence

>407048 : length: 78
CTTTCTACACAGGTTGGGATCGGTTGCAATGCTGTGTTTCTGTATGGTATTGCACTTGTC
CCGGCCTGTTGAGTTTGG

Protein Sequence

>407048 : length: 3
N/A