ONGene
Top
Scroll To Top
Gene information | Literature | Expression | lncRNA | Mutation | Homolog

Basic Information

Gene ID

407043

Name

MIR7-1

Synonym

MIRN7-1|hsa-mir-7-1|mir-7-1;microRNA 7-1;MIR7-1;microRNA 7-1

Definition

-

Position

9q21.32

Gene Type

ncRNA

External Links

Links to cell senescence gene database

407043

Links to epithelial mesenchymal transition gene database

407043

Links to ovarian cancer gene database

407043

Links to endometrial cancer gene database

407043

Links to iHOP

407043

Sequence Information

Nucleotide Sequence

>407043 : length: 110
TTGGATGTTGGCCTAGTTCTGTGTGGAAGACTAGTGATTTTGTTGTTTTTAGATAACTAA
ATCGACAACAAATCACAGTCTGCCATATGGCACAGGCCATGCCTCTACAG

Protein Sequence

>407043 : length: 3
N/A