ONGene
Top
Scroll To Top
Gene information | Literature | Expression | lncRNA | Mutation | Homolog

Basic Information

Gene ID

407041

Name

MIR34B

Synonym

MIRN34B|miRNA34B;microRNA 34b;MIR34B;microRNA 34b

Definition

hsa-mir-34b

Position

11q23.1

Gene Type

ncRNA

External Links

Links to cell senescence gene database

407041

Links to epithelial mesenchymal transition gene database

407041

Links to ovarian cancer gene database

407041

Links to endometrial cancer gene database

407041

Links to iHOP

407041

Sequence Information

Nucleotide Sequence

>407041 : length: 84
GTGCTCGGTTTGTAGGCAGTGTCATTAGCTGATTGTACTGTGGTGGTTACAATCACTAAC
TCCACTGCCATCAAAACAAGGCAC

Protein Sequence

>407041 : length: 3
N/A