ONGene
Top
Scroll To Top
Gene information | Literature | Expression | lncRNA | Mutation | Homolog

Basic Information

Gene ID

407040

Name

MIR34A

Synonym

MIRN34A|miRNA34A|mir-34;microRNA 34a;MIR34A;microRNA 34a

Definition

hsa-mir-34a

Position

1p36.22|1p36.22

Gene Type

ncRNA

External Links

Links to cell senescence gene database

407040

Links to epithelial mesenchymal transition gene database

407040

Links to ovarian cancer gene database

407040

Links to endometrial cancer gene database

407040

Links to iHOP

407040

Sequence Information

Nucleotide Sequence

>407040 : length: 110
GGCCAGCTGTGAGTGTTTCTTTGGCAGTGTCTTAGCTGGTTGTTGTGAGCAATAGTAAGG
AAGCAATCAGCAAGTATACTGCCCTAGAAGTGCTGCACGTTGTGGGGCCC

Protein Sequence

>407040 : length: 3
N/A