ONGene
Top
Scroll To Top
Gene information | Literature | Expression | lncRNA | Mutation | Homolog

Basic Information

Gene ID

407035

Name

MIR31

Synonym

MIRN31|hsa-mir-31|miR-31;microRNA 31;MIR31;microRNA 31

Definition

-

Position

9p21.3

Gene Type

ncRNA

External Links

Links to cell senescence gene database

407035

Links to epithelial mesenchymal transition gene database

407035

Links to ovarian cancer gene database

407035

Links to endometrial cancer gene database

407035

Links to iHOP

407035

Sequence Information

Nucleotide Sequence

>407035 : length: 71
GGAGAGGAGGCAAGATGCTGGCATAGCTGTTGAACTGGGAACCTGCTATGCCAACATATT
GCCATCTTTCC

Protein Sequence

>407035 : length: 3
N/A