ONGene
Top
Scroll To Top
Gene information | Literature | Expression | lncRNA | Mutation | Homolog

Basic Information

Gene ID

407033

Name

MIR30D

Synonym

MIRN30D;microRNA 30d;MIR30D;microRNA 30d

Definition

hsa-mir-30d

Position

8q24.22

Gene Type

ncRNA

External Links

Links to cell senescence gene database

407033

Links to epithelial mesenchymal transition gene database

407033

Links to ovarian cancer gene database

407033

Links to endometrial cancer gene database

407033

Links to iHOP

407033

Sequence Information

Nucleotide Sequence

>407033 : length: 70
GTTGTTGTAAACATCCCCGACTGGAAGCTGTAAGACACAGCTAAGCTTTCAGTCAGATGT
TTGCTGCTAC

Protein Sequence

>407033 : length: 3
N/A