ONGene
Top
Scroll To Top
Gene information | Literature | Expression | lncRNA | Mutation | Homolog

Basic Information

Gene ID

407027

Name

MIR301A

Synonym

MIR301|MIRN301|MIRN301A;microRNA 301a;MIR301A;microRNA 301a

Definition

hsa-mir-301|hsa-mir-301a|microRNA 301

Position

17q22

Gene Type

ncRNA

External Links

Links to cell senescence gene database

407027

Links to epithelial mesenchymal transition gene database

407027

Links to ovarian cancer gene database

407027

Links to endometrial cancer gene database

407027

Links to iHOP

407027

Sequence Information

Nucleotide Sequence

>407027 : length: 86
ACTGCTAACGAATGCTCTGACTTTATTGCACTACTGTACTTTACAGCTAGCAGTGCAATA
GTATTGTCAAAGCATCTGAAAGCAGG

Protein Sequence

>407027 : length: 3
N/A