ONGene
Top
Scroll To Top
Gene information | Literature | Expression | lncRNA | Mutation | Homolog

Basic Information

Gene ID

407018

Name

MIR27A

Synonym

MIR27|MIRN27A;microRNA 27a;MIR27A;microRNA 27a

Definition

hsa-mir-27a

Position

19p13.13

Gene Type

ncRNA

External Links

Links to cell senescence gene database

407018

Links to epithelial mesenchymal transition gene database

407018

Links to ovarian cancer gene database

407018

Links to endometrial cancer gene database

407018

Links to iHOP

407018

Sequence Information

Nucleotide Sequence

>407018 : length: 78
CTGAGGAGCAGGGCTTAGCTGCTTGTGAGCAGGGTCCACACCAAGTCGTGTTCACAGTGG
CTAAGTTCCGCCCCCCAG

Protein Sequence

>407018 : length: 3
N/A