ONGene
Top
Scroll To Top
Gene information | Literature | Expression | lncRNA | Mutation | Homolog

Basic Information

Gene ID

407011

Name

MIR23B

Synonym

MIRN23B|hsa-mir-23b|miRNA23B;microRNA 23b;MIR23B;microRNA 23b

Definition

-

Position

9q22.32

Gene Type

ncRNA

External Links

Links to cell senescence gene database

407011

Links to epithelial mesenchymal transition gene database

407011

Links to ovarian cancer gene database

407011

Links to endometrial cancer gene database

407011

Links to iHOP

407011

Sequence Information

Nucleotide Sequence

>407011 : length: 97
CTCAGGTGCTCTGGCTGCTTGGGTTCCTGGCATGCTGATTTGTGACTTAAGATTAAAATC
ACATTGCCAGGGATTACCACGCAACCACGACCTTGGC

Protein Sequence

>407011 : length: 3
N/A