ONGene
Top
Scroll To Top
Gene information | Literature | Expression | lncRNA | Mutation | Homolog

Basic Information

Gene ID

407010

Name

MIR23A

Synonym

MIRN23A|hsa-mir-23a|miRNA23A;microRNA 23a;MIR23A;microRNA 23a

Definition

-

Position

19p13.13

Gene Type

ncRNA

External Links

Links to cell senescence gene database

407010

Links to epithelial mesenchymal transition gene database

407010

Links to ovarian cancer gene database

407010

Links to endometrial cancer gene database

407010

Links to iHOP

407010

Sequence Information

Nucleotide Sequence

>407010 : length: 73
GGCCGGCTGGGGTTCCTGGGGATGGGATTTGCTTCCTGTCACAAATCACATTGCCAGGGA
TTTCCAACCGACC

Protein Sequence

>407010 : length: 3
N/A