ONGene
Top
Scroll To Top
Gene information | Literature | Expression | lncRNA | Mutation | Homolog

Basic Information

Gene ID

407009

Name

MIR224

Synonym

MIRN224|miRNA224;microRNA 224;MIR224;microRNA 224

Definition

hsa-mir-224

Position

Xq28

Gene Type

ncRNA

External Links

Links to cell senescence gene database

407009

Links to epithelial mesenchymal transition gene database

407009

Links to ovarian cancer gene database

407009

Links to endometrial cancer gene database

407009

Links to iHOP

407009

Sequence Information

Nucleotide Sequence

>407009 : length: 81
GGGCTTTCAAGTCACTAGTGGTTCCGTTTAGTAGATGATTGTGCATTGTTTCAAAATGGT
GCCCTAGTGACTACAAAGCCC

Protein Sequence

>407009 : length: 3
N/A